
Figure 1: Highest acceptance rate of gene fragments in the market. GenScript's gene fragment service can accept more challenging genes in the 1801-3000 bp range compared to other surveyed vendors (Surveyed sample size : 260 sequences).
GenTitan Gene Fragments (Now with 100% Delivery Rate) |
|
---|---|
Category | Linear dsDNA fragments |
Available Length | 200-3000 bp Upgraded |
Yield | 500 ng |
Price | Lowest Price Guarantee* |
Turnaround Time | 4 Business Days + |
Delivery Rate | 100% |
Median Error Rate | < 1/5,000 |
Adapter Options |
|
Quality Control |
|
Deliver Formats |
|
Packaging |
|
Figure 1: Highest acceptance rate of gene fragments in the market. GenScript's gene fragment service can accept more challenging genes in the 1801-3000 bp range compared to other surveyed vendors (Surveyed sample size : 260 sequences).
Figure 2. Error rate of gene fragments synthesized by GenScript and other vendors. The same 10 gene fragments (500bp to 1500bp) were synthesized from GenScript and other vendors. The sequencing data shows less than 1 error in 5,000 bp gene fragments produced by GenScript, representing atop-ranking performance on the market.
Figure 3. GenScript GenTitan Gene Fragments lead to a high percentage of correct colonies. The same 5 gene fragments (500bp to 1500bp) were synthesized from GenScript and other vendors. Then each fragment was assembled into the pUC57 vector and later transformed into competent cells. For each gene fragment, 20 colonies were picked and sequenced to calculate the % of correct colonies. For gene fragments between 500bp to 1500bp in length, GenTitan Gene Fragments outperformed other vendors enabling a high rate of correct colony selection of 94.7%.
Length | 85% Chance of getting 1 correct clone |
95% Chance of getting 1 correct clone |
---|---|---|
200-1800 bp | 2 | 3 |
1801-3000 bp | 2 | 3 |
Table 1: GenTitan Gene Fragments Optimize Screening Efficiency for Correct Clones. The number of colonies required to pick and screen in order to achieve an 85% or 95% probability of obtaining at least one correct clone.
GenSmart™ 2.0 Quick User Manual
Essential steps and tips to get familiar with ordering gene fragments via GenSmart™ 2.0
Free DownloadGenTitan Gene Fragments Flyer
Learn about the Chip-based DNA synthesis technology powered Gene
Free DownloadGenScript Molecular Biology Services Flyer
Learn all the services from the GenScript Molecular Biology portfolio in one flyer.
Free DownloadWe are committed to providing the lowest prices and will match any lower quotes or offers you receive.
If a sequence doesn’t pass our GenTitan Gene Fragment difficulty screening filter, we recommend using our GenSmart codon optimization tool to optimize the sequences. If the optimization isn’t successful, our US gene synthesis service is available for clonal products.
To enhance the likelihood of successful synthesis:
We guarantee 100% delivery of the qualified sequences. In the rare event of synthesis failure, we will provide clonal genes to ensure your research continues smoothly.
GenTitan gene fragments are not verified by NGS or Sanger sequencing due to the low cost and fast turnaround time requirements. However, due to the low error rate of our synthesis process, sequencing approximately 2-3 colonies is estimated to obtain a sequence-perfect clone with 95% confidence. If sequence-verified genes are required, please consider our US gene synthesis service.
Yes, gene fragments are purified using a bead-based method. Occasionally, there may be carryover of smaller DNA fragments.
Adapters are universal sequences added to each end of the gene fragment during synthesis. Fragments with adapters are compatible with multiple assembly methods, including restriction digest/ligation, Gateway, Golden Gate, and TOPO cloning. Below is the detailed information about the adapter.
Sequence | Length | GC% | Tm (°C) | |
---|---|---|---|---|
5’-adapter | CACGACTACAGTGAATAGGCAAGCG | 25 | 52.0 | 59.5 |
3’-adapter | GGATAGCATGCCAGTCTAGACAACG | 25 | 52.0 | 59.1 |
5'-CACGACTACAGTGAATAGGCAAGCG-insert-GGATAGCATGCCAGTCTAGACAACG-3' |
The QC process for GenTitan Gene Fragments involves gel electrophoresis to check DNA size and purity, as well as UV reading for concentration.
Gene fragments are typically delivered in a freeze-dried format in 96-well plates. Options for 2ml microcentrifuge tubes or 384-well plates are also available, with additional charges or turnaround time (TAT) for specific plate types (e.g., Echo plate). Gene fragments can also be delivered in LTE buffer (10 mM Tris-HCl, pH 7.5; 0.1 mM EDTA), with no additional shipping charge. The concentration of gene fragments can be normalized to 20ng/µl with no extra charges.
The default deliverable is 500ng (normalized) per fragment.
For restriction cloning, customer can design restriction sites within the adapters. The cloning process is similar to working with PCR products.
We do not recommend PCR amplification of the products after receipt. Gene fragments are purified using a bead-based method, which may result in the carryover of smaller DNA fragments. These smaller fragments tend to amplify more efficiently during PCR, leading to smears or additional smaller bands.
Typically, sequencing approximately 2-3 colonies should yield a sequence-perfect clone with 95% confidence. In some cases, due to the nature of DNA sequences, additional colony screenings may be necessary. When using two or more gene fragments for assembly and cloning, we strongly recommend screening more colonies or first confirming the correct individual gene fragment before proceeding with the assembly.
Currently our GenTitan Gene Fragment synthesis does not support N and K mixed bases. Please check our DNA Mutant Library for NNK library construction.