For each citation that was shared on social media (LinkedIn, Facebook, or Twitter) with the “@GenScript” tag, the author will be rewarded with a $10 Amazon gift card or 2,000 GS points.

Comparative effects of mercury chloride and methylmercury exposure on early neurodevelopment in zebrafish larvae

royal society of chemistry. 2019; 
Jun Zhu† a,  Chundan Wang†a,  Xingsu Gaoa,  Jiansheng Zhub,  Li Wanga,  Shuyuan Caoa,  Qian Wua,  Shanlei Qiao*a,  Zhan Zhang*aand Lei Li
Products/Services Used Details Operation
Gene Synthesis Total RNA was extracted from 30 living zebrafish larvae (30 hpf) treated with HgCl2 or MeHgCl using Trizol reagent. The expression of early neurogenesis related genes were measured by real-time polymerase chain reaction (PCR). The primers were synthesized by GenScript Biotech Corp. (Nanjing, China): Sonic hedgehog a (Shha) (forward AGACCGAGACTCCACGACGC and reverse, TGCAGTCACTGGTGCGAACG), Neurogenin1 (Ngn1) (forward TGCACAACCTTAACGACGCATTGG and reverse, TGCCCAGATGTAGTTGTGAGCGAA) and Neuro D (Nrd) (forward CAGCAAGTGCTTCCTTTTCC and reverse, TAAGGGGTCCGTCAAATGAG) and β-actin (forward ATGGATGAGGAAATCGCTGCC and reverse, CTCCCTGATGTCTGGGTCGTC). PCR was performed in 10 μL reaction volume on a LightCycler® 96 Detection System (Roche Diagnostics (Shanghai) Ltd., Switzerland). Get A Quote

Abstract

Mercury (Hg) is a ubiquitous environmental toxicant with important public health implications. Hg causes neurotoxicity through astrocytes, Ca2+, neurotransmitters, mitochondrial damage, elevations of reactive oxygen species and post-translational modifications. However, the similarities and differences between the neurotoxic mechanisms caused by different chemical forms of Hg remain unclear. Zebrafish embryos were exposed to methylmercury (MeHgCl) or mercury chloride (HgCl2) (0, 4, 40, 400 nM) up for 96 h. HgCl2 exposure could significantly decrease survival rate, body length and eye size, delay the hatching period, induce tail bending and reduce the locomotor activity, and these effects were aggravated in the... More

Keywords