IVD Raw Materials
Resources » Reference Databases » Citations Database
| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | CNAG_04735) was purchased from GenScript Inc.... grubii was synthesized by GenScript Co (NJ, USA), ligated into pUC57K plasmid (pUC57K- Mpr1LV), and amplified by PCR with forward primer 5′ CCTCATGAATTCATGCGCTCCTCCGCGCTCATC - GCTCTT-3′ and reverse primer 5′ ATGGCGGCCGCTCAA- TGGTGATGGTGATGATGAGCCTTTTTGGACTCGCA- 3′. | Get A Quote |
Cryptococcus neoformans (Cn) is the leading cause of fungal meningitis primarily in immunosuppressed patients. Cn invades the central nervous system by overcoming the highly restricted blood-brain barrier (BBB). We previously determined that a secreted fungal metalloprotease, Mpr1, that also confers crossing ability to yeast upon CnMPR1 expression in Saccharomyces cerevisiae is central to this process. This led us to question whether Mpr1 could be engineered to function as part of a nanocarrier delivery vehicle. Here, a eukaryotic expression system produced proteolytically active Mpr1 recombinant protein that was successfully conjugated to functionalized quantum dot (QD) nanoparticles and readily internalized b... More