GenTitan™ Gene Fragments

When We Accept, We Deliver

Home » Gene Synthesis & Molecular Biology Services » GenTitan™ Gene Fragments

합성 워크플로우

서비스 사양 (Service Specifications)

	GenTitan™ Gene Fragments (Now with 100% Delivery Rate)
Category	Linear dsDNA fragments
Available Length	200 – 1800 bp
Yield	500 ng
Price	Lowest Price Guarantee*
Turnaround Time	4 Business Days +
Median Error Rate	< 1/5,000
Adapter Options	Without adapters With adapters
Quality Control	Gel electrophoresis for size verification Spectrophotometry for concentration measurement
Deliver Formats	Tube 96-well Plate (Default) 384-well Plate

최저가 보장 정책: 오늘 저희에게 연락하셔서 조건에 따라 독점적인 최고의 제안을 받으세요.
어댑터 서열은 다음과 같습니다.
- 5'-adapter: CACGACTACAGTGAATAGGCAAGCG
- 3'-adapter: GGATAGCATGCCAGTCTAGACAACG
- 5'-CACGACTACAGTGAATAGGCAAGCG-insert-GGATAGCATGCCAGTCTAGACAACG-3'

Quote/Order Quote/Order

생산 및 응용 데이터

The error rate of GenTitan™ Gene Fragments is less than 1 in 5000 base pairs

Figure 1: Error rate of gene fragments synthesized by GenScript and other vendors. The same 10 gene fragments (500bp to 1500bp) were synthesized from GenScript and other vendors. The sequencing data shows less than 1 error in 5,000 bp gene fragments produced by GenScript, representing atop-ranking performance on the market.

Easier and faster colony screening with GenTitan™ Gene Fragments

GenScript high percentage of correct colonies

Figure 2: GenScript GenTitan™ Gene Fragments lead to a high percentage of correct colonies. The same 5 gene fragments (500bp to 1500bp) were synthesized from GenScript and other vendors. Then each fragment was assembled into the pUC57 vector and later transformed into competent cells. For each gene fragment, 20 colonies were picked and sequenced to calculate the % of correct colonies. For gene fragments between 500bp to 1500bp in length, GenTitan™ Gene Fragments outperformed other vendors enabling a high rate of correct colony selection of 94.7%.

Length	85% Chance of getting 1 correct clone	95% Chance of getting 1 correct clone
<1000bp	2	3
1000-1800bp	2	3

Table 1: GenTitan™ Gene Fragments Optimize Screening Efficiency for Correct Clones. The number of colonies required to pick and screen in order to achieve an 85% or 95% probability of obtaining at least one correct clone.

GenSmart™ 2.0 Online Ordering Platform

Order gene synthesis via GenSmart™ 2.0 with ease

Order gene fragments via GenSmart™ 2.0 with ease

Utilize the best-in-class codon optimization algorithm to optimize your sequence
Receive estimated pricing and turnaround time
Get an instant quote and place your order

Watch GenSmart™ 2.0 Tutorial

Order Now Quote/Order