• English
  • Sign In
    Please Sign In
    Sign In
    New to GenScript?
    Register
  • Contact Us
×
Contact us now: +1-877-436-7274

Job ID: xxxxxxxxxxxxxxxx
Organism: xxxxxxxxxxxxxxxx
V region delineation system: xxxxxxxxxxxxxxxx

Seq_count: The number of repetitions of a single antibody molecule; Chain type: the chain type of the antibody molecule; V gene, D gene, J gene: the best matched germline V, D and J; FR1~FR4 sequence: the best matched nucleotide of V gene.

Download
NGS Result
NO. Seq_account Organism Chain type V gene D gene J gene FR1-FR4 Sequence Details
Ab-1 10 human VH IGHV3-9*01 IGHV3-9*01 IGHV3-9*01 
GTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCT
 Details
Ab-2 9 mouse VK IGHV3-9*01 IGHV3-9*01 IGHV3-9*01 
GTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCTGTCCTAGGCT
 Details
Ab-3 8 mouse   IGHV3-9*01 IGHV3-9*01 IGHV3-9*01    
Ab-4 7     IGHV3-9*01        

Related Services you might be interested in: